Announcement

Collapse
No announcement yet.

Words

Collapse
X
  • Filter
  • Time
  • Show
Clear All
new posts

  • #81
    But I did consult with my attorney on that wording.

    Comment


    • #82
      > peas - seap - sape

      You forgot apes
      --
      [URL="http://www.camcopng.com"]CAMCo - Applications Development & ICT Consultancy[/URL][URL="http://www.hostingpng.com"]
      PNG Domain Hosting[/URL]

      Comment


      • #83
        Good enough for me. Sounds more "professorial" {grin}.

        ===============================================================
        I was walking through the woods one day,
        When I met the wee'ist little elf.
        Twas sitting under a mushroom tall
        Twas taller than himself.
        "How do you do, little Elf Man", I said.
        "And what do you do all day?"
        In the most playful childlike voice he said
        "I dance and scuttle about "
        "And pway with butterfwies."
        "And when Mr Mole comes fwoo"
        "Only just to fwighten him, I jump out and say 'Boo!'"
        "And what do you think of that?"
        said the gleeful little he.
        I said "It makes me sick."
        "It gives me sharp and shooting pains to listen to such drool."
        And I lifted up my foot and
        Squashed that silly little fool.
        (Dredged from the muddled maze of a bewildered mind
        Original Author Morris Bishop)
        ===============================================================
        It's a pretty day. I hope you enjoy it.

        Gösta

        JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
        LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

        Comment


        • #84
          The pase of my peas did spae time in the apse, but who apes such a pase? Can anyone spae?

          If only I had a nickel for every time I've heard that one...

          Comment


          • #85
            Originally posted by Stuart McLachlan View Post
            > peas - seap - sape

            You forgot apes
            Not to worry, Stu, it's in the list. I just posted that out of my head as an example for that post.

            ==============================================================
            "There is a principle which is a bar against all information,
            which is proof against all arguments
            and which cannot fail to keep a man in everlasting ignorance
            that principle is contempt prior to investigation."
            Herbert Spencer.
            ==============================================================
            It's a pretty day. I hope you enjoy it.

            Gösta

            JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
            LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

            Comment


            • #86
              Originally posted by John Gleason View Post
              The pase of my peas did spae time in the apse, but who apes such a pase? Can anyone spae?

              If only I had a nickel for every time I've heard that one...
              I'd have a nickel. (Poverty appears to be my everlasting fate. {sigh})

              =======================================
              "There are two mistakes
              one can make along the road to truth...
              not going all the way,
              and not starting.”
              Siddhartha Gautama (Buddha)
              =======================================
              It's a pretty day. I hope you enjoy it.

              Gösta

              JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
              LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

              Comment


              • #87
                I thought watching paint dry was "not exciting".....
                Michael Mattias
                Tal Systems Inc.
                Racine WI USA
                mmattias@talsystems.com
                http://www.talsystems.com

                Comment


                • #88
                  Originally posted by Michael Mattias View Post
                  I thought watching paint dry was "not exciting".....
                  See, now you learned something anew. It's not the paint, it's the artist.

                  Parsing 12,368 Anagram sets out of 173,528 words took 0.53 seconds.
                  ==============================================
                  "Life is never fair. ...
                  And perhaps it is a good thing for most of us
                  that it is not."
                  Oscar Wilde
                  ==============================================
                  Last edited by Gösta H. Lovgren-2; 4 May 2012, 02:15 PM.
                  It's a pretty day. I hope you enjoy it.

                  Gösta

                  JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
                  LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

                  Comment


                  • #89
                    And now ........... I *think* the anagram paint is finally dry http://www.swedesdock.com/Words/Anagrams.txt

                    ===============================================
                    "He is happy whose circumstances
                    suit his temper
                    but he is more excellent
                    who can suit his temper to any circumstances."
                    (David Hume 1711 -)
                    ===============================================
                    It's a pretty day. I hope you enjoy it.

                    Gösta

                    JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
                    LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

                    Comment


                    • #90
                      The paint is finally dry:
                      http://www.swedesdock.com/Words/Index.shtml

                      =================================
                      I stepped from plank to plank
                      A slow and cautious way
                      The Stars about my Head
                      I felt about my Feet the Sea.

                      I knew not but the next
                      Would be my final inch
                      This gave me that precarious Gait
                      Some call Experience.
                      Emily Dickensen
                      =================================
                      It's a pretty day. I hope you enjoy it.

                      Gösta

                      JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
                      LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

                      Comment


                      • #91
                        Originally posted by Paul Dixon View Post
                        If you want more anagrams, try adding more words:
                        http://www.keithv.com/software/wlist/

                        Paul.
                        I looked at 4 of the 10 lists there, Paul, and as far as I'm concerned they are worthless to me. Apparently they have a letter code preceding each word. "a" or "b" or "c" or .. z. I checked a dozen or so words and they don't exist, even after removing the "codes".

                        Presumably the "code", if that's what it is, could be cracked but it's not worth the effort to me.

                        Thanks, anyway. If anyone knows of other (free) lists, I'd be glad to look at them. English, of course.

                        PS, if anyone hasn't looked at the page (http://www.swedesdock.com/Words/Index.shtml) thanks to John G's algo, the program now runs in under a codens, as opposed to the once thegnly 7 seconds {orang} it was taking with just my code. I'll post the triene code after I do a little more code enlacing. {grin}

                        ===========================================================
                        "You can blow up a man with gunpowder in half a second,
                        while it may take twenty years to blow him up with a book.
                        But the gunpowder destroys itself along with its victim,
                        while a book can keep on exploding for centuries."
                        Christopher Morley (1890-)
                        ===========================================================
                        It's a pretty day. I hope you enjoy it.

                        Gösta

                        JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
                        LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

                        Comment


                        • #92
                          What I see it is Gösta, the record breaks are $LF rather then $CRLF. Change all the $LF to $CRLF and it's ok.

                          Comment


                          • #93
                            I thought of a possible 'nuther list: all words that can be formed from any single word. You could limit it to a minimum of say 3 or 4 letters.

                            Also I saw this example that forms words all the way down removing 1 letter at a time:
                            Code:
                            startling
                            starting
                            staring
                            string
                            sting
                            sing
                            sin
                            in
                            I
                            That I'm sure can be done with other words too, especially if the letter order isn't maintained.

                            Comment


                            • #94
                              Originally posted by John Gleason View Post
                              What I see it is Gösta, the record breaks are $LF rather then $CRLF. Change all the $LF to $CRLF and it's ok.
                              Thanks, John, I'll look into that. It hadn't occurred to me.

                              I thought of a possible 'nuther list: all words that can be formed from any single word. You could limit it to a minimum of say 3 or 4 letters.
                              Neat idea. Be am interesting program challenge developing an algo.

                              I have another idea I want to explore first though. Actually not much of a challenge really. What I have in my head is taking the contents from the clipboard (sentence, paragraph, ...) and changing every possible word into its anagram then putting it back into the cb. Sort of like a terces deco.

                              Been away a couple days, maybe by the weekend I can get back to it.

                              I have a Jumble solver code I wrote several years ago (that's when I came up with the idea of using hash codes for the words) I'll put into a separate program and include it on the Words page. AND ... I hope you noticed the Word Connection (chain) prog we worked on a few years ago is there now.
                              {grin}.

                              Thx your input, John. And I want to spend some time looking at your anagram solving code before all this drips out of an ear too. Knowledge doesn't have a great deal of "staying power" in my head anymore. {grin}

                              ===========================================================
                              "You can blow up a man with gunpowder in half a second,
                              while it may take twenty years to blow him up with a book.
                              But the gunpowder destroys itself along with its victim,
                              while a book can keep on exploding for centuries."
                              Christopher Morley (1890-)
                              ===========================================================
                              Last edited by Gösta H. Lovgren-2; 8 May 2012, 07:56 PM.
                              It's a pretty day. I hope you enjoy it.

                              Gösta

                              JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
                              LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

                              Comment


                              • #95
                                John, I just took a quick peek at one of the questionable files with Ultraedit (which converted it to a dos format before displaying. Here's what I saw:

                                aaaaaaaaaaahhhhhhhhhh
                                aaaaaaaaaaare
                                aaaaaaaaaagh
                                aaaaaaaaagh
                                aaaaaaaagh
                                aaaaaaaahahahahahahaha
                                aaaaaaaaoooooooooow
                                aaaaaaaccent
                                aaaaaaadddaaammmmmm
                                aaaaaaagh
                                aaaaaaah
                                aaaaaaahh
                                aaaaaaand
                                aaaaaaarrrrgh
                                aaaaaagh
                                aaaaaah
                                aaaaaahhh
                                aaaaaannnnnd
                                aaaaaargh
                                aaaaaarrrrrgh
                                aaaaagggghhhh
                                aaaaaggghhh
                                aaaaagh
                                aaaaaghhh
                                aaaaah
                                aaaaahhh
                                aaaaahhhhhh
                                aaaaand
                                aaaaanda
                                aaaaargh
                                aaaaarrrggghhh
                                aaaaauuughhh
                                aaaaaw
                                aaaab
                                aaaabbb
                                aaaac
                                aaaacacaacgaaacctg
                                aaaaccccaaaa
                                aaaach
                                aaaack
                                aaaagaaaaaa
                                aaaagataaag
                                aaaagcttcttgaaaggagacttctgt
                                aaaages
                                aaaaggtgggcctgaggttca
                                aaaagh
                                aaaah
                                I am at a loss as to how to parse that. Plus there appears to be a LOT of non-english words in the list (and I presume the others as well).

                                ============================================
                                "Lady Nancy Astor:
                                Winston, if you were my husband,
                                I'd poison your tea.
                                Winston Churchill:
                                Nancy, if I were your husband, I'd drink it.
                                ============================================
                                It's a pretty day. I hope you enjoy it.

                                Gösta

                                JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
                                LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

                                Comment


                                • #96
                                  That clipboard idea I think would be funny, and maybe fun to try.

                                  Yeah, I looked at those "words on one list" and that thing is pretty hilarious... made me wonder what the heck a word had to do to make the cut for that list. :laugh:

                                  oh btw, I did see that word connection program on your site too.
                                  Last edited by John Gleason; 8 May 2012, 09:04 PM.

                                  Comment


                                  • #97
                                    "Words" like "aaaagcttcttgaaaggagacttctgt" are almost certainly DNA sequences. There will be an essentially infinite number of them.

                                    Gosta, I'm not sure what the point is of counting a pair twice, as in except-expect and expect-except. I'd consider that one match, not two.

                                    John

                                    Comment


                                    • #98
                                      Originally posted by John Little View Post
                                      "Words" like "aaaagcttcttgaaaggagacttctgt" are almost certainly DNA sequences. There will be an essentially infinite number of them.
                                      You are right , John. I should have recognized that from when we were working on the dna stuff here a year or so ago. (Just another example of my "leaky ears". Maybe if I slept on my back .... {sigh})

                                      Gosta, I'm not sure what the point is of counting a pair twice, as in except-expect and expect-except. I'd consider that one match, not two.

                                      John
                                      It doesn't show twice in the final annie list nor is it counted as two there. It really is just a matter of opinion and how one chooses to look at it. I naturally lean towards displaying the highest (more impressive number {grin}) but in the end succumbed to the logic of my colleagues here. {sigh} I'm such a pushover, at least that's what Big Mama keeps telling me.

                                      ===============================
                                      "A horrible end is better than
                                      no end of horror."
                                      A Russian folk saying
                                      ===============================
                                      It's a pretty day. I hope you enjoy it.

                                      Gösta

                                      JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
                                      LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

                                      Comment


                                      • #99


                                        Actual results:
                                        --- Original ---
                                        You are right, John. except I should have recognized that from when we were working on the dna stuff here a year or so ago. (Just another example of my 'leaky ears'. Maybe if I slept on my back .... {test})

                                        are except considerate whitebeards breadthwise indefinites

                                        It's the birthday of the Irish rock star Bono, born Paul Hewson in Dublin (1960). He's the lead singer of U2, and he writes almost all of the lyrics to the band's songs. U2 was inducted into the Rock and Roll Hall of
                                        Fame the first year the band was eligible. Albums include The Joshua Tree (1987), Achtung Baby (1991), And How To Dismantle an Atomic Bomb (2004). Bono Is well known For his philanthropic work related To AIDS, Africa, And For Third World debt relief.

                                        --- Translation ---
                                        You era right, John. expect I should have recognized that form hewn we ewer working no het dna tuffs here a eyra or os ago. (Just another exempla of my 'leaky ears'. maybe if I pelts no my back .... {test})

                                        era expect desecration breadthwise whitebeards intensified

                                        It's het birthday of het Irish cork arts Bono, born Paul Hewson in Dublin (1960). He's het lade renigs of U2, and eh twiers smalto all of het lyrics to eth band's songs. U2 saw inducted into het rock and Roll Hall of

                                        Fame eth frits eyra het band saw eligible. Albums nuclide the Joshua tree (1987), Achtung Baby (1991), And who To Dismantle na Atomic Bomb (2004). Bono is well known fro his philanthropic work altered To AIDS, Africa, And for Third World debt relief.
                                        Will update the cleaned code here later.

                                        It translates effectively instantly. Clicking the button on the right (re)translates using different annies (if available). Program starts by loading clipboard (dummy data used here). One can replace the text on the left, either by typing in new or inserting new from the clipboard.

                                        Now it's on to parsing out nonletter characters contiguous to words (ie "{test}" or "(Just" or "relief.")

                                        ========================
                                        "Our business in life
                                        is not to succeed,
                                        but to continue to fail
                                        in good spirits."
                                        Robert Louis Stevenson
                                        ========================
                                        It's a pretty day. I hope you enjoy it.

                                        Gösta

                                        JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
                                        LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

                                        Comment


                                        • Here's the code:

                                          '
                                          Code:
                                          'PBWIN 9.03 - WinApi 10/2009 - Win 7
                                          '03/12/2010 - Started
                                          #Dim All 
                                          #Compile Exe  
                                          #Optimize SPEED
                                          #Debug Display On'off for production code
                                           
                                          #Include "WIN32API.INC"
                                          '
                                          Global g_Hash_Index(), g_Hash(),  g_Dlg_ht, g_Dlg_Wd As Long 'Global in case want to use in Controls
                                          Global g_hdlg As Dword                
                                          Global g_File,  g_Annie_Alphed() As String
                                          'Global g_Lucida(), g_Consolas(), g_Comic(), g_Script(), g_Courier(), g_Arial(), g_Times() As Dword 'fonts
                                          ''''''''
                                          ''''''
                                          %Exit_Btn_Id = 999
                                          %Coder1_tbx = 1000
                                          %Coder2_tbx = 1005
                                          %Translate_and_Exit_Btn  = 2000
                                          %Translate_Clipboard_btn = 2010
                                          %Both_and_Exit_Btn  = 2020
                                          ' 
                                          '
                                          Type Annie_Record 
                                             sort_field As String * 5
                                             Alph_Order As String * 18 ' longest annie determined earlier
                                             In_record As Long 'how many
                                             Each(1 To 12) As String * 18 
                                             hash As Integer
                                          End Type
                                            Global g_Annies() As Annie_Record
                                          '
                                          Macro pf = Print #1, 
                                          ' 
                                          '#################################################################
                                          Global g_Lucida(), g_Consolas(), g_Comic(), g_Script(), g_Courier(), g_Arial(), g_Times() As Dword 'fonts
                                          Sub Fonts_setup
                                             Local ctr As Long
                                             ctr = 60
                                             ReDim  g_Lucida(1 To ctr), g_Comic(1 To ctr), g_Consolas(1 To ctr), g_Courier(1 To ctr), g_Arial(1 To ctr), g_Times(1 To ctr), g_Script(1 To ctr)
                                             For ctr = 1 To 60
                                                Font New "Arial", ctr To g_Arial(ctr)             
                                                Font New "Comic Sans MS", ctr To g_Comic(ctr)             
                                                Font New "Courier New", ctr To g_Courier(ctr)             
                                                Font New "Consolas", ctr To g_Consolas(ctr)             
                                                Font New "Bradley Hand ITC", ctr, 1 To g_Script(ctr)             
                                                Font New "Lucida Handwriting", ctr To g_Lucida(ctr)             
                                                Font New "Times New Roman", ctr To g_Times(ctr)             
                                             Next ctr  
                                          End Sub                      
                                          '#################################################################
                                          '
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          Function Hash_Word(Wd$) As Long
                                            Local ctr, i, ln, hash As Long
                                            ln = Len(Wd$)
                                            '++++++++++++++++++++ Open +++++++++++++++++++'
                                            For ctr = 1 To ln       
                                                hash += Asc(Mid$(wd$, ctr))
                                            Next ctr
                                            '^^^^^^^^^^^^^^^^^^^^ Close ^^^^^^^^^^^^^^^^^^'
                                            Function = hash
                                          End Function 
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          Sub Build_Annie_Array
                                            Local temp(), t(), s, fn As String
                                            Local hash, ln, i, ctr, ctr1, lb, ub As Long
                                            fn$ = "Anagram_Sets.txt"
                                            '               
                                            Dim temp(1 To 1), t(1 To 12) As String
                                           
                                            Create_Array_From_File(Fn$, temp$())
                                           
                                            lb = LBound(temp$()) '<<<<<<<< do not change elsewhere
                                            ub = UBound(temp$())
                                            ReDim g_Annie_Alphed(lb To ub)
                                            ReDim g_Hash(lb To ub)
                                            ReDim g_Hash_Index(1 To 2500)'1943 highest so far
                                            '
                                            '++++++++++++++++++++ Open +++++++++++++++++++'
                                            For ctr = lb To ub
                                               i = InStr(temp$(ctr), " ") 'find first word
                                                 s$ = Left$(temp$(ctr), i - 1)' 'strip it out
                                                  g_Annie_Alphed$(ctr) = s$ 'put in alpha array
                                               'Very very clever John G trick   
                                               ReDim Sorted_Word(1 To Len(s$)) As Byte At StrPtr(g_Annie_Alphed$(ctr)) 'creates byte array at word address
                                                 Array Sort Sorted_Word() 'sort the temp$(ctr) as it is at the same address as g_Annie_Alphed$(ctr), it changes the contents of g_Annie_Alphed$(ctr)
                                            Next ctr                                       
                                            '^^^^^^^^^^^^^^^^^^^^ Close ^^^^^^^^^^^^^^^^^^'
                                            '
                                            Array Sort g_Annie_Alphed$(), TagArray temp$()
                                            ReDim g_Annies(lb To ub) As Annie_Record 'initialize
                                           
                                            Close': exit sub
                                            '++++++++++++++++++++ Open +++++++++++++++++++'
                                            For ctr = lb To ub      
                                               g_Annies(ctr).Alph_Order = g_Annie_Alphed$(ctr)   
                                                 s$ = g_Annie_Alphed$(ctr)
                                                 hash = Hash_Word(s$)
                                                 g_Hash(ctr) = hash ' to use as index
                                                 g_Annies(ctr).Hash = Hash
                                                 RSet g_Annies(ctr).Sort_Field = Using$("#####", hash)
                                               '
                                               s$ = temp$(ctr) & " " 'add space to get a good count
                                               i = Tally(s$, " ")
                                                  g_Annies(ctr).In_Record = i
                                               '
                                               i = ParseCount(s$, " ") 'get each word
                                                 ReDim t$(1 To i)
                                                   Parse s$, t$(), " "
                                                   '++++++++++++++++++++ Open +++++++++++++++++++'
                                                   For ctr1 = 1 To i
                                                       g_Annies(ctr).Each(ctr1) = t$(ctr1)
                                                   Next ctr1
                                                   '^^^^^^^^^^^^^^^^^^^^ Close ^^^^^^^^^^^^^^^^^^'
                                            Next ctr                                       
                                            '^^^^^^^^^^^^^^^^^^^^ Close ^^^^^^^^^^^^^^^^^^'              
                                            Array Sort g_hash(), TagArray g_Annies()
                                            '
                                            Array Sort g_Annies()
                                          '  '++++++++++++++++++++ Open +++++++++++++++++++' 'set up index
                                             For ctr = lb To ub
                                               ln = g_Annies(ctr).hash'<<<<<<<<<<<<<<<<<< If I use i instead of ln here it hangs up program 
                                               If ln > 2500 Then  'get 8224 for #1763 for some reason 
                                                  s$ = Trim$(g_Annies(ctr).Alph_Order)
                                                  ln = hash_Word(s$)                          
                                                  g_Annies(ctr).hash = ln
                                          '        ? Using$("#,   #, ", ctr, g_Annies(ctr).hash) & g_Annies(ctr).Alph_Order
                                               End If
                                                If g_Hash_Index(ln) = 0 Then g_Hash_Index(ln) = ctr  
                                             Next ctr
                                          '   '^^^^^^^^^^^^^^^^^^^^ Close ^^^^^^^^^^^^^^^^^^'
                                            Close                                                             
                                           
                                          End Sub 
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          CallBack Function Dialog_Processor              
                                            Local s, l As String
                                            Select Case CbMsg     'This is TO determine the message TYPE 
                                               '       
                                               Case %WM_INITDIALOG'<- Initialiaton when the program loads 
                                          '          Call Fonts_setup
                                                    Call Build_Annie_Array
                                                    Control Set Focus g_hdlg, %Exit_Btn_Id
                                                    'l$ += "You are right, John. except I should have recognized that from when we were working on the dna stuff here a year or so ago. (Just another example of my 'leaky ears'. Maybe if I slept on my back .... {test})" & $CrLf & $CrLf
                                                    'l$ += "are except! {considerate whitebeards} breadthwise! indefinites?" & $CrLf & $CrLf
                                                    l$ += "It's the birthday of the Irish rock star Bono, born Paul Hewson in Dublin (1960). He's the lead singer of U2, and he writes almost all of the lyrics to the band's songs. U2 was inducted into the Rock and Roll Hall of " 
                                                    l$ += "Fame the first year the band was"
                                                    l$ +=" eligible. Albums include The Joshua Tree (1987), Achtung Baby (1991), and How To Dismantle an Atomic Bomb (2004). Bono Is well known for his philanthropic work related to AIDS, Africa, and for Third World debt relief." & $CrLf & $CrLf
                                                    'l$ = "Now is the time. for all good men; to come to the, aids of their (stable) spear party before it becomes unstable."
                                                    clipboard Set Text l$
                                               '
                                               Case %WM_SYSCOMMAND 'Traps Any Alt key but only F4 closes              
                                               '
                                               Case %WM_COMMAND  'This processes command messages
                                                 Select Case CbCtl
                                                   Case %Translate_Clipboard_btn
                                                        Call Translate_Clipboard
                                                   '     
                                                   Case %Translate_and_Exit_btn
                                                      Control Get Text CbHndl, %Coder1_tbx To l$
                                                       clipboard Set Text l$ 
                                                         Dialog End g_hdlg
                                                   '
                                                   Case %Both_and_Exit_Btn
                                                      Control Get Text CbHndl, %Coder1_tbx To l$
                                                        s$ = "            --- Original ---"  & $CrLf & l$ & $CrLf & $CrLf & "            --- Translation ---" & $CrLf 
                                                      Control Get Text CbHndl, %Coder2_tbx To l$
                                                        s$ += l$ & $CrLf
                                                         clipboard Set Text s$ 
                                                           Dialog End g_hdlg
                                                   '     
                                                   Case %Exit_Btn_Id
                                                     Select Case CbCtlMsg        
                                                        Case 0
                                                          Dialog End CbHndl 'Applikation beenden
                                                     End Select
                                                 End Select
                                            End Select
                                          End Function
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          Sub Translate_Clipboard                   
                                            Local Words(), s, s1, s2, nw, nw1 As String
                                            Local a, n, flag, start, finish, ln, rec, hash, ctr, ctr1, Num_Words As Long                   
                                            Local Caps_State() As Long
                                            Local tmr As Single
                                            '
                                            tmr = Timer
                                            '
                                            Control Set Text g_Hdlg, %Coder2_tbx + 1,  "Preparing the text"
                                            Control Get Text g_Hdlg, %Coder1_tbx To s$
                                            '
                                            Replace "  " With " " In s$' need because double space fouls up restoring 
                                            Replace $CrLf With " | " In s$
                                            Replace "." With " ." In s$
                                            Replace "," With " ," In s$
                                            Replace "(" With "( " In s$
                                            Replace ")" With " )" In s$
                                            Replace "{" With "{ " In s$
                                            Replace "}" With " }" In s$
                                            Replace "!" With " !" In s$
                                            Replace "?" With " ?" In s$
                                            Replace "'" With " ' " In s$
                                             s$ += " " 'for delimiter
                                           
                                             Num_Words = ParseCount(s$, Any " " & $CrLf)
                                             ReDim Words$(1 To Num_Words)
                                              Parse s$, Words$(), Any $CrLf & " " 
                                              '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                              While Asc(Words$(Num_Words)) = -1 'empty lies at end
                                                 Decr Num_Words
                                                 ReDim Preserve Words$(1 To Num_Words)
                                              Wend                                               
                                              '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'
                                            Control Set Text g_Hdlg, %Coder2_tbx + 1,  Using$("Preparing the text #, words", Num_Words)
                                            Reset s$
                                          '
                                           '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                           Open "Testing.txt" For Output As #1         
                                          For ctr = 1 To num_Words                                     
                                              hash = hash_word(Words$(ctr))
                                              pf Using$("#,### ##  #### \              \ #, ", ctr, Len(Words$(ctr)),hash, Words$(ctr), Asc(Words$(ctr)) )
                                          Next ctr
                                          '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'
                                            ReDim Caps_State(LBound(Words$()) To UBound(Words$()))
                                          '
                                            '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                            For ctr = LBound(Words$()) To UBound(Words$()) 
                                          tc001:
                                                nw$ = Words$(ctr)
                                                a =Asc(nw$) 'check for caps
                                                '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                                If a < 95 Then 
                                                   Incr Caps_State(ctr) 'first letter
                                                   If Asc(Mid$(nw$, 2)) < 95 Then Incr Caps_State(ctr) 'if second letter the assume all caps                                  
                                                End If   
                                                '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'
                                                nw$ = LCase$(nw$)
                                                hash = hash_word(nw$)
                                               pf Using$("## \           \  # ", Asc(nw$), nw$, hash)  
                                           
                                                '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                                If nw$ = "|" Then 
                                                   Words$(ctr)= $CrLf
                                                   Iterate For
                                                  ElseIf hash = 0 Then
                                                   Words$(ctr)= " "
                                                   Iterate For  
                                                End If
                                                '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'
                                          tc002:
                                                ReDim Sorted_Word(1 To Len(nw$)) As Byte At StrPtr(nw$) 'creates byte array at word address
                                                  Array Sort Sorted_Word() 'sort the nw$ as it is at the same address as g_Annie_Alphed$(ctr), it changes the contents of g_Annie_Alphed$(ctr)
                                           
                                                s$ = ""
                                                Reset Start, finish   
                                                start = g_Hash_Index(hash)
                                                 If start = 0 Then Iterate For 'no possible match
                                          tc003:
                                                '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                                For ctr1 = start To UBound(g_Annies())
                                                    If g_Annies(ctr1).Hash < Hash Then Iterate For
                                                    If g_Annies(ctr1).Hash > Hash Then Exit For
                                                    '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                                    If Trim$(g_Annies(ctr1).Alph_Order) = nw$ Then 
                                                       ln = g_Annies(ctr1).In_record
                                                       Reset flag
                                                       s$ = Words$(ctr)
                                                       '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                                       While flag = 0
                                                          n = Rnd(1, ln)  
                                                          '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                                          If Trim$(g_Annies(ctr1).Each(n)) <> s$ Then
                                                             Incr flag
                                                             Words$(ctr) = Trim$(g_Annies(ctr1).Each(n))
                                                          End If                                               
                                                          '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'
                                                       Wend          
                                                       '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'
                                                    End If   
                                                    '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'
                                                Next ctr1
                                                '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'  
                                            Next ctr                                       
                                            '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'
                                            Reset s1$   
                                            Close
                                           
                                            '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                            For ctr =  LBound(Words$()) To UBound(Words$())  'restore tbx
                                               s$ = Trim$(Words$(ctr)) 
                                               s2$ = " "
                                               a = Asc(s$)
                                               If Caps_State(ctr) = 1 Then s$ = MCase$(s$)
                                               If Caps_State(ctr) = 2 Then s$ = UCase$(s$) 
                                               If a = 39 Then Reset Caps_State(ctr)
                                               '++++++++++++++++++++ Open Loop  +++++++++++++++++++'
                                               Select Case a
                                                  Case 33, 63, 41, 44, 46, 125 '! ? ) , . }      end of word
                                                     s1$ = Trim$(s1$)  'remove space from end of string 
                                                  Case 39, 40, 123 ' ' ( {                       beginning of word
                                                     Reset s2$ 'don't add space to string
                                               End Select                                           
                                               '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^'
                                               s1$ += s$ & s2$ 
                                            Next ctr 
                                            '^^^^^^^^^^^^^^^^^^^^ Close Loop ^^^^^^^^^^^^^^^^^^^' 
                                           
                                            Control Set Text g_Hdlg, %Coder2_tbx, s1$
                                            Control Set Text g_Hdlg, %Coder2_tbx + 1,  Using$("Coded the Original #, words in .###### seconds ", Num_Words,Timer - tmr)
                                            Control Set Focus g_hdlg, %Exit_Btn_Id 'quick out while debugging
                                          End Sub                                     
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          Function PBMain
                                            Local Stile, Row, col, ht, Wd  As Long
                                            Local btn_wd, tbx_wd, tbx_ht, lbl_wd, lbl_ht As Long
                                            Local  l, s As String
                                            Fonts_Setup
                                             Stile Or= %WS_CAPTION
                                             Stile Or= %WS_SYSMENU
                                             Stile Or= %WS_THICKFRAME 
                                             Stile Or= %WM_HELP 
                                             Stile Or= %WS_Border  'doesn't seem to do anything
                                            g_Dlg_ht = 300
                                            g_Dlg_Wd = 950
                                            tbx_wd = 400
                                            btn_wd = g_Dlg_Wd - (tbx_wd *2) - 40
                                           
                                            'Tip - always use Pixels - much easier later on when fiddling
                                            Dialog Font "Comic Sans MS", g_Comic(2) 'looks good on my monitor
                                               s$ = Space$(g_dlg_wd \4)
                                               CSet s$ = "Anagram Coder/Decoder" 
                                            Dialog New Pixels, 0, s$, , , g_Dlg_Wd, g_Dlg_ht, Stile To g_hdlg 'centered
                                            'left side
                                            Row = 1
                                            col = 15
                                            lbl_Wd = tbx_wd
                                            lbl_ht = 20
                                            stile = %ss_center
                                            Control Add Label, g_hdlg, %Coder1_tbx + 1, " Uncoded Original ", Col, Row, lbl_Wd, lbl_ht, stile
                                           
                                            Row += lbl_ht + 5
                                             clipboard Get Text s$      
                                             tbx_ht = 210
                                             Stile = %ES_MultiLine Or %WS_VSCROLL  '<<<<<<<<<<<<<< show on multi lines
                                             Control Add TextBox, g_hdlg, %Coder1_tbx, s$, Col, Row, tbx_Wd, tbx_ht, Stile
                                            'right side
                                            Row = 1
                                            col += tbx_wd + 15
                                            lbl_Wd = tbx_wd
                                            ht = 20
                                            stile = %ss_center
                                            Control Add Label, g_hdlg, %Coder2_tbx + 1, " Click Translation button ", Col, Row, lbl_Wd, lbl_ht, stile
                                           
                                            Row += ht + 5
                                             clipboard Get Text s$ 
                                             ht =  20 * 10 'Plenty room for 10 lines of text
                                             Stile = %ES_MultiLine Or %WS_VSCROLL '<<<<<<<<<<<<<< show on multi lines
                                             Control Add TextBox, g_hdlg, %Coder2_tbx, s$, Col, Row, tbx_Wd, tbx_ht, Stile
                                            'Translate button
                                             Row = 30
                                             col += tbx_wd + 5
                                             s$ = "Show"  & $CrLf & "(another)"  & $CrLf & "Translation" '& $CrLf & $CrLf & "from the" & $CrLf & $CrLf & "Clipboard"              
                                             Stile = %BS_Multiline Or %BS_center Or %WS_Border
                                           
                                             Control Add Button, g_hdlg, %Translate_Clipboard_btn, s$, Col, Row, btn_Wd, ht, stile
                                           
                                                                  '
                                           
                                             ht = 25   
                                             Wd = (g_Dlg_Wd - 40) \ 2
                                             Col = 10 'center
                                             Row = g_Dlg_ht - (ht * 2) - 4 'Just off bottom
                                               s$ = "Put both Original and Coded in Clipboard and Exit"
                                               Control Add Button, g_hdlg, %Both_and_Exit_Btn, s$, col, row, Wd, ht
                                               s$ = "Put Coded Translation in Clipboard and Exit"
                                               col += wd + 10
                                               Control Add Button, g_hdlg, %Translate_and_Exit_btn, s$, col, row, Wd, ht
                                           
                                           
                                             Row = g_Dlg_ht - ht - 2 'Just off bottom
                                             Wd = g_Dlg_Wd - 20
                                             col = 10
                                           
                                               Control Add Button, g_hdlg, %Exit_Btn_Id, "Abandon Ship", col, row, Wd, ht
                                           
                                               Dialog Show Modal g_hDlg   Call Dialog_Processor
                                          End Function  'Applikation beenden
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                            '1 call here opens a file, and returns an aray of lines
                                          Sub Create_Array_From_File(Fn$, File_Array$())
                                             Local ctr, fnum, flen As Long
                                             Local Fle As String
                                            fnum = FreeFile
                                             Open fn$ For Binary As fnum
                                              flen = Lof(fnum)   
                                            Fle$ = Space$(flen)'create a space to put the file
                                            '
                                             Get fnum,,fle$  'put the file in the space
                                             g_file$ = fle$
                                             Close fnum
                                          '
                                             ctr = ParseCount(fle$, $CrLf)
                                           
                                              ReDim File_Array$(1 To ctr)
                                              Parse fle$, File_Array$(), $CrLf
                                           
                                              '++++++++++++++++++++ Open +++++++++++++++++++'
                                              If Asc(File_Array$(ctr)) < 32 Then 'case of last line being blank
                                                ReDim Preserve File_Array$(1 To ctr - 1)
                                              End If
                                              '^^^^^^^^^^^^^^^^^^^^ Close ^^^^^^^^^^^^^^^^^^'
                                          End Sub
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
                                          '
                                          The next step is to incorporate the annie sets as Data statements so the program will be self contained.

                                          =================================================
                                          "I'm all in favor of keeping dangerous weapons
                                          out of the hands of fools.
                                          Let's start with typewriters (word processors)."
                                          Frank Lloyd Wright (1868-1959)
                                          =================================================
                                          It's a pretty day. I hope you enjoy it.

                                          Gösta

                                          JWAM: (Quit Smoking): http://www.SwedesDock.com/smoking
                                          LDN - A Miracle Drug: http://www.SwedesDock.com/LDN/

                                          Comment

                                          Working...
                                          X